| Detail of EST/Unigene BF646801 |
| Acc. | BF646801 |
| Internal Acc. | NF075A01EC1F1003 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Dihydropyrimidine dehydrogenase [NADP(+)] OS=Caenorhabditis elegans E-value=2e-13; Probable dihydropyrimidine dehydrogenase [NADP(+)] OS=Caenorhabditis briggsae E-value=2e-13; Dihydropyrimidine dehydrogenase [NADP(+)] OS=Danio rerio E-value=1e-12; NAD-dependent dihydropyrimidine dehydrogenase subunit PreA OS=Salmonella typhimurium (strain LT2 / SGSC1412 / ATCC 700720) E-value=2e-12; Dihydropyrimidine dehydrogenase [NADP(+)] OS=Dictyostelium discoideum E-value=2e-12; |
| Length | 538 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | GCACGAGGCTTGTTTCTTCCTCTGTTTTTCTTCTTCCTTTTCTGAATCTTGCAGAAAGTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K00207 dihydropyrimidine dehydrogenase (NADP+); Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K00207 dihydropyrimidine dehydrogenase (NADP+); Metabolism > Metabolism of Other Amino Acids > ko00410 beta-Alanine metabolism > K00207 dihydropyrimidine dehydrogenase (NADP+); Metabolism > Metabolism of Cofactors and Vitamins > ko00770 Pantothenate and CoA biosynthesis > K00207 dihydropyrimidine dehydrogenase (NADP+) |
| EC | 1.3.1.1 1.3.1.2 1.3.3.1 1.3.99.11 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821049 |
| Trichome-related Gene from Literature | N/A |