| Detail of EST/Unigene BF647036 |
| Acc. | BF647036 |
| Internal Acc. | NF092D03EC1F1028 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetate/butyrate--CoA ligase AAE7, peroxisomal OS=Arabidopsis thaliana E-value=2e-47; Probable acyl-activating enzyme 2 OS=Arabidopsis thaliana E-value=9e-28; Benzoate--CoA ligase, peroxisomal OS=Arabidopsis thaliana E-value=9e-28; Butyrate--CoA ligase AAE11, peroxisomal OS=Arabidopsis thaliana E-value=3e-27; Probable acyl-activating enzyme 12, peroxisomal OS=Arabidopsis thaliana E-value=5e-27; |
| Length | 384 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | CACACACGGAACGGAAGAACGCAGTGGCGATGGGTACGAAACAAGACATAGACGACCTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820946 |
| Trichome-related Gene from Literature | N/A |