Detail of EST/Unigene BF647190 |
Acc. | BF647190 |
Internal Acc. | NF040E06EC1F1050 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, chloroplastic OS=Glycine max E-value=3e-71; Omega-3 fatty acid desaturase, chloroplastic (Fragment) OS=Brassica napus E-value=3e-66; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=8e-65; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=5e-63; Omega-3 fatty acid desaturase, chloroplastic OS=Sesamum indicum E-value=2e-62; |
Length | 619 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CAGAATGTGGTTTAAAGTCACCTTGCTCCAGTATTTCCAAAACCAAGAACAGGTTTTGCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |