Detail of EST/Unigene BF647214 |
Acc. | BF647214 |
Internal Acc. | NF039F01EC1F1013 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=3e-21; UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=2e-20; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=6e-19; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=1e-18; UDP-arabinopyranose mutase 2 OS=Arabidopsis thaliana E-value=3e-18; |
Length | 196 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CAAAAACACTCTCATCAACAACAACAACAATGGCTTCTTCATCCAAACCAACACCACTTN |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820039 |
Trichome-related Gene from Literature | 820039 |