| Detail of EST/Unigene BF647214 |
| Acc. | BF647214 |
| Internal Acc. | NF039F01EC1F1013 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=3e-21; UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=2e-20; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=6e-19; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=1e-18; UDP-arabinopyranose mutase 2 OS=Arabidopsis thaliana E-value=3e-18; |
| Length | 196 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | CAAAAACACTCTCATCAACAACAACAACAATGGCTTCTTCATCCAAACCAACACCACTTN |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820039 |
| Trichome-related Gene from Literature | 820039 |