| Detail of EST/Unigene BF647510 |
| Acc. | BF647510 |
| Internal Acc. | NF009H05EC1F1046 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase 2 OS=Arabidopsis thaliana E-value=4e-40; Type I inositol 1,4,5-trisphosphate 5-phosphatase 1 OS=Arabidopsis thaliana E-value=2e-25; Type I inositol 1,4,5-trisphosphate 5-phosphatase CVP2 OS=Arabidopsis thaliana E-value=2e-22; Phosphatidylinositol 4,5-bisphosphate 5-phosphatase INP51 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-06; |
| Length | 544 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | GTGAAGATGATGTTTGTTCTCCTAAACAACCAAGAATGCAAATTAGTGATGATAGTCCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 3.1.3.36 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827526 |
| Trichome-related Gene from Literature | N/A |