Detail of EST/Unigene BF647510 |
Acc. | BF647510 |
Internal Acc. | NF009H05EC1F1046 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Type I inositol 1,4,5-trisphosphate 5-phosphatase 2 OS=Arabidopsis thaliana E-value=4e-40; Type I inositol 1,4,5-trisphosphate 5-phosphatase 1 OS=Arabidopsis thaliana E-value=2e-25; Type I inositol 1,4,5-trisphosphate 5-phosphatase CVP2 OS=Arabidopsis thaliana E-value=2e-22; Phosphatidylinositol 4,5-bisphosphate 5-phosphatase INP51 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-06; |
Length | 544 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GTGAAGATGATGTTTGTTCTCCTAAACAACCAAGAATGCAAATTAGTGATGATAGTCCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.1.3.36 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827526 |
Trichome-related Gene from Literature | N/A |