Detail of EST/Unigene BF647720 |
Acc. | BF647720 |
Internal Acc. | NF025C12EC1F1097 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-fructofuranosidase, cell wall isozyme OS=Pisum sativum E-value=0; Beta-fructofuranosidase, insoluble isoenzyme CWINV1 OS=Arabidopsis thaliana E-value=8e-85; Beta-fructofuranosidase, insoluble isoenzyme CWINV3 OS=Arabidopsis thaliana E-value=1e-69; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Oryza sativa subsp. japonica E-value=1e-69; Beta-fructofuranosidase, insoluble isoenzyme 3 OS=Oryza sativa subsp. indica E-value=1e-69; |
Length | 651 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | AATTAAACTACAATGGCTATCTCTCCAATTTTATTGATAGCTCTCTTCTCTCTTATTTAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820591 |
Trichome-related Gene from Literature | N/A |