Detail of EST/Unigene BF647737 |
Acc. | BF647737 |
Internal Acc. | NF011D07EC1F1060 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chorismate synthase 1, chloroplastic OS=Solanum lycopersicum E-value=2e-19; Chorismate synthase, chloroplastic OS=Arabidopsis thaliana E-value=9e-19; Chorismate synthase 2, chloroplastic OS=Solanum lycopersicum E-value=2e-18; Chorismate synthase, chloroplastic OS=Corydalis sempervirens E-value=1e-15; Chorismate synthase OS=Cyanothece sp. (strain PCC 8801) E-value=7e-11; |
Length | 556 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | AGCTCATAGCCCGTGGTCGTCATGATCCCTGTGTTGTCCCGAGAGCTGTACCCATGGTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841307 |
Trichome-related Gene from Literature | N/A |