Detail of EST/Unigene BF648170 |
Acc. | BF648170 |
Internal Acc. | NF038D05EC1F1045 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutamate dehydrogenase 3 OS=Arabidopsis thaliana E-value=0; Glutamate dehydrogenase 1 OS=Arabidopsis thaliana E-value=0; Glutamate dehydrogenase OS=Solanum lycopersicum E-value=0; Glutamate dehydrogenase B OS=Nicotiana plumbaginifolia E-value=0; Glutamate dehydrogenase 2 OS=Arabidopsis thaliana E-value=0; |
Length | 663 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CTTGAATATCTCTTACTAAAGGTTGAAAAAAATTGTTTGTATTAGTCTTTACAATGAATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Energy Metabolism > ko00910 Nitrogen metabolism > K00261 glutamate dehydrogenase (NAD(P)+); Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K00261 glutamate dehydrogenase (NAD(P)+); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K00261 glutamate dehydrogenase (NAD(P)+); Metabolism > Metabolism of Other Amino Acids > ko00471 D-Glutamine and D-glutamate metabolism > K00261 glutamate dehydrogenase (NAD(P)+) |
EC | 1.4.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821072 |
Trichome-related Gene from Literature | N/A |