Detail of EST/Unigene BF648215 |
Acc. | BF648215 |
Internal Acc. | NF038H06EC1F1059 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 18, mitochondrial OS=Arabidopsis thaliana E-value=4e-54; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=1e-52; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=2e-50; Nudix hydrolase 21, chloroplastic OS=Arabidopsis thaliana E-value=8e-45; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=2e-33; |
Length | 640 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GTTACAACGTTATAGAAAAGGTCGTCGCCAAGTTGTTGGATGTATACCATACAGATATAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 3.6.1.52 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838051 |
Trichome-related Gene from Literature | N/A |