Detail of EST/Unigene BF648399 |
Acc. | BF648399 |
Internal Acc. | NF047B07EC1F1060 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=4e-71; Cyanogenic beta-glucosidase (Fragment) OS=Trifolium repens E-value=5e-70; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=7e-67; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=9e-67; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=1e-65; |
Length | 632 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CAATTATAAAATAAGCACTTATGACATTAAACATGAGATATCTCCTATTTTCTCTCTTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 817104 |
Trichome-related Gene from Literature | N/A |