| Detail of EST/Unigene BF648885 |
| Acc. | BF648885 |
| Internal Acc. | NF052F10EC1F1089 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=4e-68; Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=2e-36; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=4e-36; Probable beta-1,3-galactosyltransferase 3 OS=Arabidopsis thaliana E-value=7e-18; Probable beta-1,3-galactosyltransferase 1 OS=Arabidopsis thaliana E-value=2e-16; |
| Length | 659 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | CAACATTGTTGAACAGAATTGGATTCGAAATTCAAAATGCAGAGCAAGGGATCGAGTCAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835415 |
| Trichome-related Gene from Literature | N/A |