Detail of EST/Unigene BF649170 |
Acc. | BF649170 |
Internal Acc. | NF054H04EC1F1042 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | ABC transporter C family member 14 OS=Arabidopsis thaliana E-value=9e-53; ABC transporter C family member 4 OS=Arabidopsis thaliana E-value=1e-50; ABC transporter C family member 3 OS=Arabidopsis thaliana E-value=2e-32; Putative ABC transporter C family member 15 OS=Arabidopsis thaliana E-value=2e-29; ABC transporter C family member 9 OS=Arabidopsis thaliana E-value=7e-29; |
Length | 526 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | TGACAGTCCGCGCATTCAGAAAACAGAAAGAATTTCGTTTAGAAAATTTTAAAAGAGTGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05665 ATP-binding cassette, subfamily C (CFTR/MRP), member 1; Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05666 ATP-binding cassette, subfamily C (CFTR/MRP), member 2; Environmental Information Processing > Membrane Transport > ko02010 ABC transporters > K05667 ATP-binding cassette, subfamily C (CFTR/MRP), member 3 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | 3.A.1 ATP-binding-cassette superfamily ABC ABC-type importers (all from Bacteria and Archaea) |
Probeset |
|
Corresponding NCBI Gene | 825444 |
Trichome-related Gene from Literature | N/A |