Detail of EST/Unigene BF649198 |
Acc. | BF649198 |
Internal Acc. | NF056F07EC1F1061 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Citrullus lanatus E-value=3e-78; Cysteine synthase OS=Triticum aestivum E-value=2e-77; Cysteine synthase, chloroplastic/chromoplastic OS=Capsicum annuum E-value=2e-77; Cysteine synthase, chloroplastic/chromoplastic OS=Solanum tuberosum E-value=4e-77; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=2e-76; |
Length | 653 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CTTTCTTCATCAGATAACATGGAGCAACACTTTGCAATCAAGAAGGATGTCACTCAATTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827145 |
Trichome-related Gene from Literature | 827145 |