Detail of EST/Unigene BF649387 |
Acc. | BF649387 |
Internal Acc. | NF056H04EC1F1042 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=1e-40; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=1e-34; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=2e-31; Probable glucan endo-1,3-beta-glucosidase A6 OS=Arabidopsis thaliana E-value=9e-31; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=2e-28; |
Length | 652 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CTCAAAAAAAATAATAACATGACAACAAAAACAACCCTCCTCTTCCTCTTCCTCCTCCAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824709 |
Trichome-related Gene from Literature | N/A |