| Detail of EST/Unigene BF649392 |
| Acc. | BF649392 |
| Internal Acc. | NF079F07EC1F1062 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71B4 OS=Arabidopsis thaliana E-value=5e-52; Cytochrome P450 71B23 OS=Arabidopsis thaliana E-value=1e-50; Cytochrome P450 71B3 OS=Arabidopsis thaliana E-value=4e-50; Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=5e-50; Cytochrome P450 71B25 OS=Arabidopsis thaliana E-value=4e-49; |
| Length | 637 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | TCTTGATCCAGAAAGGAAGAAGTTGCCTCCACATGAGGATGATGTTATTGATGCCTTGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07422 cytochrome P450, family 2, subfamily U |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822231 |
| Trichome-related Gene from Literature | N/A |