Detail of EST/Unigene BF649603 |
Acc. | BF649603 |
Internal Acc. | NF080E06EC1F1050 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cinnamoyl-CoA reductase 2 OS=Arabidopsis thaliana E-value=3e-64; Cinnamoyl-CoA reductase 1 OS=Arabidopsis thaliana E-value=3e-64; Tetraketide alpha-pyrone reductase 1 OS=Arabidopsis thaliana E-value=3e-35; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Pyrus communis E-value=9e-33; Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase OS=Malus domestica E-value=9e-33; |
Length | 645 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GAAGCATCTATCTTCCATATTTGAGTTATTACATTATTCTTTGCTATCTCCATTGGTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00070 3beta-hydroxy-delta5-steroid dehydrogenase; Metabolism > Lipid Metabolism > ko00100 Biosynthesis of steroids > K07748 sterol-4alpha-carboxylate 3-dehydrogenase (decarboxylating) |
EC | 1.1.1.145 1.1.1.181 5.3.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844421 |
Trichome-related Gene from Literature | N/A |