Detail of EST/Unigene BF649935 |
Acc. | BF649935 |
Internal Acc. | NF085F05EC1F1045 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 71D8 OS=Glycine max E-value=1e-52; Premnaspirodiene oxygenase OS=Hyoscyamus muticus E-value=4e-49; Cytochrome P450 71D6 OS=Solanum chacoense E-value=6e-48; Cytochrome P450 71D7 OS=Solanum chacoense E-value=3e-47; 5-epiaristolochene 1,3-dihydroxylase OS=Nicotiana tabacum E-value=2e-43; |
Length | 587 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GTCTCAAGGTCATAAGTGCCAATTTCACTGTATGCCATGGAATTCAAATTTTCCTTCCTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00140 C21-Steroid hormone metabolism > K00512 cytochrome P450, family 17, subfamily A (steroid 17alpha-monooxygenase); Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
EC | 1.14.14.1 1.14.99.9 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 822237 |
Trichome-related Gene from Literature | N/A |