| Detail of EST/Unigene BF650325 |
| Acc. | BF650325 |
| Internal Acc. | NF096A04EC1F1023 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Exostosin-2 OS=Drosophila melanogaster E-value=8e-17; Exostosin-3 OS=Drosophila melanogaster E-value=1e-16; Exostosin-like 3 OS=Mus musculus E-value=6e-15; Exostosin-2 OS=Mus musculus E-value=6e-15; Exostosin-2 OS=Homo sapiens E-value=1e-14; |
| Length | 527 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | GTTATTCTTACGATAATCTTTGTAGTTGGAGTTGGATTGATGTGCATGGGATTTAAAAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02367 glucuronyl/N-acetylglucosaminyl transferase EXT2; Metabolism > Glycan Biosynthesis and Metabolism > ko01030 Glycan structures - Biosynthesis 1 > K02370 alpha-1,4-N-acetylglucosaminyltransferase EXTL3; Metabolism > Glycan Biosynthesis and Metabolism > ko00534 Heparan sulfate biosynthesis > K02370 alpha-1,4-N-acetylglucosaminyltransferase EXTL3 |
| EC | 2.4.1.223 2.4.1.224 2.4.1.225 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 830329 |
| Trichome-related Gene from Literature | N/A |