| Detail of EST/Unigene BF650329 |
| Acc. | BF650329 |
| Internal Acc. | NF095F05EC1F1045 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Frataxin, mitochondrial OS=Arabidopsis thaliana E-value=6e-22; Frataxin, mitochondrial OS=Dictyostelium discoideum E-value=9e-13; Frataxin, mitochondrial OS=Bos taurus E-value=1e-12; Frataxin, mitochondrial OS=Homo sapiens E-value=2e-12; Frataxin, mitochondrial OS=Mus musculus E-value=2e-12; |
| Length | 660 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | CACAAAGCATTCAGCTTTGTTTTCTGTCATCATCACCGATTCTTCCTCTCAATTAACAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 828013 |
| Trichome-related Gene from Literature | N/A |