Detail of EST/Unigene BF650422 |
Acc. | BF650422 |
Internal Acc. | NF096G11EC1F1086 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Mitogen-activated protein kinase 3 OS=Arabidopsis thaliana E-value=2e-88; Mitogen-activated protein kinase 6 OS=Arabidopsis thaliana E-value=6e-84; Mitogen-activated protein kinase homolog NTF4 OS=Nicotiana tabacum E-value=2e-83; Mitogen-activated protein kinase homolog MMK1 OS=Medicago sativa E-value=2e-83; Mitogen-activated protein kinase homolog D5 OS=Pisum sativum E-value=1e-82; |
Length | 668 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | ACATTATTTAAATTGAAATTCACCGCCTTCTTCTTCAACACACTACCATCGCCGACGCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04441 p38 MAP kinase; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04464 mitogen-activated protein kinase 7; Environmental Information Processing > Signal Transduction > ko04011 MAPK signaling pathway - yeast > K04464 mitogen-activated protein kinase 7 |
EC | 2.7.1.- 2.7.11.24 |
Transcription Factor Family | WRKY |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 823706 |
Trichome-related Gene from Literature | N/A |