Detail of EST/Unigene BF650608 |
Acc. | BF650608 |
Internal Acc. | NF099A06EC1F1039 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 83B1 OS=Arabidopsis thaliana E-value=2e-31; Cytochrome P450 71A9 OS=Glycine max E-value=4e-27; Cytochrome P450 83A1 OS=Arabidopsis thaliana E-value=3e-26; 2-methylbutanal oxime monooxygenase OS=Manihot esculenta E-value=4e-26; Cytochrome P450 71B3 OS=Arabidopsis thaliana E-value=3e-25; |
Length | 512 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | AATTCCGCACGAGGGAGAGAGAACGTTCAAGGTTTCAGATGAACTTTATCAAAGTATTGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07410 cytochrome P450, family 1, subfamily B, polypeptide 1; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K07418 cytochrome P450, family 2, subfamily J; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07418 cytochrome P450, family 2, subfamily J |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829277 |
Trichome-related Gene from Literature | N/A |