Detail of EST/Unigene BF650795 |
Acc. | BF650795 |
Internal Acc. | NF100C11EC1F1084 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase-like protein 1 OS=Arabidopsis thaliana E-value=2e-20; Glucan endo-1,3-beta-glucosidase 7 OS=Arabidopsis thaliana E-value=7e-20; Glucan endo-1,3-beta-glucosidase 12 OS=Arabidopsis thaliana E-value=1e-19; Glucan endo-1,3-beta-glucosidase 1 OS=Arabidopsis thaliana E-value=8e-19; Glucan endo-1,3-beta-glucosidase 3 OS=Arabidopsis thaliana E-value=3e-18; |
Length | 668 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | CAGGTTCAAGTAGGACAGAAAAGGAAGCACAAAGAGAAGTTAATGTACTAAAAAGACATG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 3767975 |
Trichome-related Gene from Literature | N/A |