Detail of EST/Unigene BF650825 |
Acc. | BF650825 |
Internal Acc. | NF101A07EC1F1051 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized AAA domain-containing protein Rv2559c/MT2636 OS=Mycobacterium tuberculosis E-value=6e-08; DNA-dependent ATPase MGS1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-07; ATPase WRNIP1 OS=Rattus norvegicus E-value=2e-07; ATPase WRNIP1 homolog C26H5.02c OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-07; ATPase WRNIP1 OS=Mus musculus E-value=2e-07; |
Length | 656 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | AAAGCTTACTAAGAATGAAGACGATTTGGTTTGGTTTGTAATAAGTTGTTGGAAGAAGAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839045 |
Trichome-related Gene from Literature | N/A |