| Detail of EST/Unigene BF650825 |
| Acc. | BF650825 |
| Internal Acc. | NF101A07EC1F1051 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Uncharacterized AAA domain-containing protein Rv2559c/MT2636 OS=Mycobacterium tuberculosis E-value=6e-08; DNA-dependent ATPase MGS1 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-07; ATPase WRNIP1 OS=Rattus norvegicus E-value=2e-07; ATPase WRNIP1 homolog C26H5.02c OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=2e-07; ATPase WRNIP1 OS=Mus musculus E-value=2e-07; |
| Length | 656 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | AAAGCTTACTAAGAATGAAGACGATTTGGTTTGGTTTGTAATAAGTTGTTGGAAGAAGAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10755 replication factor C subunit 2/4; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10755 replication factor C subunit 2/4 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839045 |
| Trichome-related Gene from Literature | N/A |