Detail of EST/Unigene BF650952 |
Acc. | BF650952 |
Internal Acc. | NF098D06EC1F1048 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | GMP synthase [glutamine-hydrolyzing] OS=Brachyspira hyodysenteriae (strain ATCC 49526 / WA1) E-value=4e-28; GMP synthase [glutamine-hydrolyzing] OS=Desulfotalea psychrophila (strain LSv54 / DSM 12343) E-value=2e-27; GMP synthase [glutamine-hydrolyzing] OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) E-value=2e-27; GMP synthase [glutamine-hydrolyzing] OS=Vibrio vulnificus (strain YJ016) E-value=8e-27; GMP synthase [glutamine-hydrolyzing] OS=Vibrio vulnificus (strain CMCP6) E-value=8e-27; |
Length | 531 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | GTTGGTTCTACTAGCAAGAGAGTACAGCAGCCAACAACATAAACCCTAGAATTCTTTCAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00983 Drug metabolism - other enzymes > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K01951 GMP synthase (glutamine-hydrolysing); Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01951 GMP synthase (glutamine-hydrolysing) |
EC | 6.3.5.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842670 |
Trichome-related Gene from Literature | N/A |