Detail of EST/Unigene BF651257 |
Acc. | BF651257 |
Internal Acc. | NF109E09EC1F1069 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Calcium-dependent protein kinase 32 OS=Arabidopsis thaliana E-value=5e-65; Calcium-dependent protein kinase 7 OS=Arabidopsis thaliana E-value=1e-63; Calcium-dependent protein kinase 8 OS=Arabidopsis thaliana E-value=2e-62; Calcium-dependent protein kinase 14 OS=Arabidopsis thaliana E-value=4e-62; Calcium-dependent protein kinase 13 OS=Arabidopsis thaliana E-value=1e-59; |
Length | 456 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | ACGAAATCGAAACTCGTTACGAACTCGGTCGTGAACTCGGTAGAGGTGAATTCGGTGTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04150 mTOR signaling pathway > K04373 p90 ribosomal S6 kinase; Environmental Information Processing > Signal Transduction > ko04020 Calcium signaling pathway > K05869 calcium/calmodulin-dependent protein kinase IV |
EC | 2.7.11.1 2.7.11.17 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824920 |
Trichome-related Gene from Literature | N/A |