| Detail of EST/Unigene BG123565 |
| Acc. | BG123565 |
| Internal Acc. | EST469211 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Triticum aestivum E-value=4e-94; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=8e-92; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-90; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-90; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-90; |
| Length | 661 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_SHOOT_4WEEK; |
| Sequence | AGCAAAAAACTTCATATATAATCAATCTCTAGTAATCTACAATTGCTAGGTTTACATGGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818006 |
| Trichome-related Gene from Literature | N/A |