Detail of EST/Unigene BG123565 |
Acc. | BG123565 |
Internal Acc. | EST469211 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic OS=Triticum aestivum E-value=4e-94; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=8e-92; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-90; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-90; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=2e-90; |
Length | 661 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_SHOOT_4WEEK; |
Sequence | AGCAAAAAACTTCATATATAATCAATCTCTAGTAATCTACAATTGCTAGGTTTACATGGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |