Detail of EST/Unigene BG123797 |
Acc. | BG123797 |
Internal Acc. | EST469443 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 2, chloroplastic OS=Hordeum vulgare E-value=0; Chlorophyll a-b binding protein, chloroplastic OS=Apium graveolens E-value=0; Chlorophyll a-b binding protein 2, chloroplastic OS=Glycine max E-value=0; Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Glycine max E-value=0; Chlorophyll a-b binding protein 48, chloroplastic OS=Zea mays E-value=0; |
Length | 741 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_SHOOT_4WEEK; |
Sequence | GGGCTGCTTCTACTATGGCTCTTTCCTCCTCTACTTTCGCCGGTAAGGCGGTGAAACTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 815058 |
Trichome-related Gene from Literature | N/A |