| Detail of EST/Unigene BG123845 |
| Acc. | BG123845 |
| Internal Acc. | EST469491 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=6e-60; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=4e-58; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=8e-56; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Brassica napus E-value=1e-55; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-55; |
| Length | 775 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_SHOOT_4WEEK; |
| Sequence | TCCTAAAACCTCTCATCAACCGCAAAACCCTAGAGCTTCCAGCCGCCTCTTTACTTATTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820288 |
| Trichome-related Gene from Literature | 820288 |