| Detail of EST/Unigene BG124815 |
| Acc. | BG124815 |
| Internal Acc. | EST470461 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acetyl-CoA carboxylase 1 OS=Arabidopsis thaliana E-value=0; Acetyl-CoA carboxylase 2 OS=Arabidopsis thaliana E-value=0; Acetyl-CoA carboxylase 1 OS=Oryza sativa subsp. japonica E-value=0; Acetyl-CoA carboxylase 2 OS=Oryza sativa subsp. japonica E-value=0; Acetyl-CoA carboxylase OS=Dictyostelium discoideum E-value=2e-69; |
| Length | 763 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_SHOOT_4WEEK; |
| Sequence | GCACTTCCTATTTCAACTCCTGTGGATCCTCCAGAGAGACCTGTTGAGTACTTCCAGAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00061 Fatty acid biosynthesis > K01946 biotin carboxylase; Metabolism > Carbohydrate Metabolism > ko00640 Propanoate metabolism > K11262 acetyl-CoA carboxylase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K11262 acetyl-CoA carboxylase; Metabolism > Lipid Metabolism > ko00061 Fatty acid biosynthesis > K11262 acetyl-CoA carboxylase |
| EC | 6.3.4.14 6.4.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 840521 |
| Trichome-related Gene from Literature | 840521 |