Detail of EST/Unigene BG126251 |
Acc. | BG126251 |
Internal Acc. | EST471897 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Spinacia oleracea E-value=8e-79; Cysteine synthase OS=Citrullus lanatus E-value=2e-76; Cysteine synthase OS=Oryza sativa subsp. japonica E-value=1e-75; Cysteine synthase, chloroplastic/chromoplastic OS=Spinacia oleracea E-value=2e-75; Cysteine synthase OS=Brassica juncea E-value=1e-74; |
Length | 709 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_SHOOT_4WEEK; |
Sequence | GTAATACTGGCATTGGTCTGGCATTTGTAGCTGCAGCTCGTGGCTACAAACTCGTGATAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
EC | 2.5.1.47 4.2.1.22 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827145 |
Trichome-related Gene from Literature | 827145 |