| Detail of EST/Unigene BG128852 |
| Acc. | BG128852 |
| Internal Acc. | EST474498 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=9e-31; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=6e-24; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=5e-19; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-19; 30S ribosomal protein S17 OS=Rickettsia bellii (strain RML369-C) E-value=4e-10; |
| Length | 781 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_SHOOT_4WEEK; |
| Sequence | GACAATGTCTGTAACTTCTCCTCTTCTCTCTCAATTCAAATCCCTCACCATTTCCACCCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 844324 |
| Trichome-related Gene from Literature | 844324 |