Detail of EST/Unigene BG128852 |
Acc. | BG128852 |
Internal Acc. | EST474498 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 30S ribosomal protein S17, chloroplastic OS=Arabidopsis thaliana E-value=9e-31; 30S ribosomal protein S17, chloroplastic (Fragment) OS=Pisum sativum E-value=6e-24; 30S ribosomal protein S17, chloroplastic OS=Zea mays E-value=5e-19; 30S ribosomal protein S17, chloroplastic OS=Oryza sativa subsp. japonica E-value=6e-19; 30S ribosomal protein S17 OS=Rickettsia bellii (strain RML369-C) E-value=4e-10; |
Length | 781 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_SHOOT_4WEEK; |
Sequence | GACAATGTCTGTAACTTCTCCTCTTCTCTCTCAATTCAAATCCCTCACCATTTCCACCCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844324 |
Trichome-related Gene from Literature | 844324 |