| Detail of EST/Unigene BG129445 |
| Acc. | BG129445 |
| Internal Acc. | EST475091 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=1e-20; Chlorophyll a-b binding protein, chloroplastic OS=Zea mays E-value=1e-20; Chlorophyll a-b binding protein 1, chloroplastic OS=Zea mays E-value=1e-20; Chlorophyll a-b binding protein, chloroplastic OS=Spinacia oleracea E-value=1e-20; Chlorophyll a-b binding protein 91R, chloroplastic OS=Petunia sp. E-value=1e-20; |
| Length | 141 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_SHOOT_4WEEK; |
| Sequence | GCTGGGCTTGCCAAGTTGTGTTGATGGGAGCCGATGAGGGTTACCGTATTGCTGGTGGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822391 |
| Trichome-related Gene from Literature | N/A |