| Detail of EST/Unigene BG130005 |
| Acc. | BG130005 |
| Internal Acc. | EST475651 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein, chloroplastic (Fragment) OS=Silene pratensis E-value=5e-58; Chlorophyll a-b binding protein of LHCII type I, chloroplastic OS=Lemna gibba E-value=3e-57; Chlorophyll a-b binding protein 215, chloroplastic OS=Pisum sativum E-value=1e-56; Chlorophyll a-b binding protein type I, chloroplastic OS=Pinus thunbergii E-value=7e-56; Chlorophyll a-b binding protein 1B, chloroplastic OS=Solanum lycopersicum E-value=4e-51; |
| Length | 494 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_SHOOT_4WEEK; |
| Sequence | TGGTAGCTTTGAAGGTGGACGTGTCACCATGCCGACGTACTGTCAAAAGTGCACCACAAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 839871 |
| Trichome-related Gene from Literature | 839871 |