Detail of EST/Unigene BG130139 |
Acc. | BG130139 |
Internal Acc. | EST475785 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 3C, chloroplastic OS=Solanum lycopersicum E-value=6e-97; Chlorophyll a-b binding protein 50, chloroplastic OS=Nicotiana tabacum E-value=6e-95; Chlorophyll a-b binding protein 16, chloroplastic OS=Nicotiana tabacum E-value=3e-94; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=1e-93; Chlorophyll a-b binding protein E, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-93; |
Length | 636 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_SHOOT_4WEEK; |
Sequence | GTACATTCAAGAGTTTCTCATTCTACTTCTATAATGGCTACTTCTACCATGGGCTCTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 839871 |
Trichome-related Gene from Literature | 839871 |