Detail of EST/Unigene BG137722 |
Acc. | BG137722 |
Internal Acc. | EST478164 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Glycine max E-value=5e-14; Omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-13; Temperature-sensitive omega-3 fatty acid desaturase, chloroplastic OS=Arabidopsis thaliana E-value=1e-13; Omega-3 fatty acid desaturase, chloroplastic OS=Ricinus communis E-value=2e-13; Omega-3 fatty acid desaturase, endoplasmic reticulum OS=Nicotiana tabacum E-value=5e-13; |
Length | 356 nt |
Species | Solanum pennellii |
Belonged EST Libraries | SL_WTP; |
Sequence | GTAAAATCTTAAAACCTCTCATCAACCGCAAAACCCTAGAGCTTCCAGCCGCCTCTTTAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 820288 |
Trichome-related Gene from Literature | 820288 |