Detail of EST/Unigene BG447537 |
Acc. | BG447537 |
Internal Acc. | NF013H02ST1F1000 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Inactive hydroxysteroid dehydrogenase-like protein 1 OS=Bos taurus E-value=3e-19; Inactive hydroxysteroid dehydrogenase-like protein 1 OS=Homo sapiens E-value=1e-18; Putative steroid dehydrogenase let-767 OS=Caenorhabditis briggsae E-value=3e-18; Inactive hydroxysteroid dehydrogenase-like protein 1 OS=Pongo abelii E-value=4e-18; Putative steroid dehydrogenase let-767 OS=Caenorhabditis elegans E-value=1e-17; |
Length | 436 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | GCAAATTCTTTTTCCATTTTTTCAACTGGATATGGATCATGTTCTTAAGACCACACAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
EC | 1.1.1.- 1.1.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843098 |
Trichome-related Gene from Literature | N/A |