Detail of EST/Unigene BG447626 |
Acc. | BG447626 |
Internal Acc. | NF117C11ST1F1085 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Zea mays E-value=9e-80; Transketolase, chloroplastic OS=Spinacia oleracea E-value=2e-79; Transketolase, chloroplastic OS=Solanum tuberosum E-value=5e-79; Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=3e-73; Transketolase 7 OS=Craterostigma plantagineum E-value=4e-71; |
Length | 446 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DSTEM2; |
Sequence | TAACAAGCCTGACAGTGAGATTGTTGACCATTACACGTATGTTATATTGGGAGATGGTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
EC | 2.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825246 |
Trichome-related Gene from Literature | N/A |