| Detail of EST/Unigene BG447778 |
| Acc. | BG447778 |
| Internal Acc. | NF093A03EC1F1021 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 750A1 OS=Pinus taeda E-value=3e-34; Flavonoid 3'-monooxygenase OS=Petunia hybrida E-value=3e-33; Cytochrome P450 71A2 OS=Solanum melongena E-value=3e-33; Cytochrome P450 71A3 (Fragment) OS=Solanum melongena E-value=3e-32; Flavonoid 3',5'-hydroxylase OS=Campanula medium E-value=4e-32; |
| Length | 592 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | ACCACCTGGCCCAAAATCATGGCCCATAATAGGAAATCTCAATCTTATTGGATCACTTCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822221 |
| Trichome-related Gene from Literature | N/A |