Detail of EST/Unigene BG447857 |
Acc. | BG447857 |
Internal Acc. | NF107B05EC1F1043 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase, mitochondrial OS=Daucus carota E-value=3e-17; Citrate synthase, mitochondrial OS=Citrus maxima E-value=6e-16; Citrate synthase, mitochondrial OS=Fragaria ananassa E-value=1e-15; Citrate synthase 4, mitochondrial OS=Arabidopsis thaliana E-value=5e-10; Citrate synthase 5, mitochondrial OS=Arabidopsis thaliana E-value=7e-09; |
Length | 320 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | ATTCTACTTTTCAACCGCTTGTTCTATTGATTCGTCTAAATGGCGTTTTTCCGAAGCCGT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 2.3.3.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819042 |
Trichome-related Gene from Literature | N/A |