| Detail of EST/Unigene BG447903 |
| Acc. | BG447903 |
| Internal Acc. | NF103C05EC1F1036 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=0; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=4e-87; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=6e-67; Lichenase OS=Nicotiana plumbaginifolia E-value=8e-67; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=2e-64; |
| Length | 664 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_ECELL; |
| Sequence | AATCCTTCTTTCATATTCATTTTTAGTGTATACTTTATTTTGCATCATACCTTCTTTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |