Detail of EST/Unigene BG447973 |
Acc. | BG447973 |
Internal Acc. | NF104D10EC1F1080 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 28 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=2e-28; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana sylvestris E-value=3e-27; 31 kDa ribonucleoprotein, chloroplastic OS=Arabidopsis thaliana E-value=1e-26; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=2e-25; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=3e-21; |
Length | 685 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | TTTCATTTCTACAACGCTACCCTTATCCACAAACAACGATATTGTTGTGTTGTTCCTTTC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835090 |
Trichome-related Gene from Literature | N/A |