Detail of EST/Unigene BG448363 |
Acc. | BG448363 |
Internal Acc. | NF024C04EC1F1023 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | NAD(P)H-dependent 6'-deoxychalcone synthase OS=Glycine max E-value=7e-81; NADPH-dependent codeinone reductase 1-3 OS=Papaver somniferum E-value=5e-41; NADPH-dependent codeinone reductase 1-4 OS=Papaver somniferum E-value=6e-41; NADPH-dependent codeinone reductase 1-5 OS=Papaver somniferum E-value=1e-40; NADPH-dependent codeinone reductase 1-1 OS=Papaver somniferum E-value=1e-40; |
Length | 611 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_ECELL; |
Sequence | ATAGCATAATTCACTCAAAGTGTAACAATCTTAACATTGAACCTTAGTCCAACCCAAAAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
EC | 1.1.1.21 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842290 |
Trichome-related Gene from Literature | N/A |