Detail of EST/Unigene BG448564 |
Acc. | BG448564 |
Internal Acc. | NF037A07RT1F1050 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Seed linoleate 9S-lipoxygenase OS=Glycine max E-value=7e-96; Seed linoleate 9S-lipoxygenase-2 OS=Pisum sativum E-value=7e-91; Seed linoleate 9S-lipoxygenase-2 OS=Glycine max E-value=4e-88; Seed linoleate 9S-lipoxygenase-3 OS=Pisum sativum E-value=2e-87; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=3e-86; |
Length | 635 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_DROOT; |
Sequence | CAAAAAGACACTGAATTACAAACTTGGTGGAAGGAAGTTGTAGAAAAAGGTCATGGTGAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00460 arachidonate 15-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00460 arachidonate 15-lipoxygenase; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00461 arachidonate 5-lipoxygenase; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K00461 arachidonate 5-lipoxygenase; |
EC | 1.13.11.31 1.13.11.33 1.13.11.34 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841944 |
Trichome-related Gene from Literature | 841944 |