| Detail of EST/Unigene BG448629 |
| Acc. | BG448629 |
| Internal Acc. | NF044E10NR1F1072 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Pisum sativum E-value=0; UDP-arabinopyranose mutase 3 OS=Arabidopsis thaliana E-value=0; Alpha-1,4-glucan-protein synthase [UDP-forming] 1 OS=Solanum tuberosum E-value=0; Alpha-1,4-glucan-protein synthase [UDP-forming] 2 OS=Solanum tuberosum E-value=0; Alpha-1,4-glucan-protein synthase [UDP-forming] OS=Zea mays E-value=0; |
| Length | 674 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_NOD_ROOT; |
| Sequence | CATCAACAACAACAACAATGGCTTCTTCATCCAAACCAACACCACTTCTCAAAGATGAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820039 |
| Trichome-related Gene from Literature | 820039 |