Detail of EST/Unigene BG448764 |
Acc. | BG448764 |
Internal Acc. | NF045B07NR1F1058 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 20 OS=Arabidopsis thaliana E-value=0; Probable beta-1,3-galactosyltransferase 18 OS=Arabidopsis thaliana E-value=1e-82; Probable beta-1,3-galactosyltransferase 19 OS=Arabidopsis thaliana E-value=3e-81; Probable beta-1,3-galactosyltransferase 17 OS=Arabidopsis thaliana E-value=2e-79; Beta-1,3-galactosyltransferase 15 OS=Arabidopsis thaliana E-value=2e-25; |
Length | 678 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | AAACGTCCGGTTATTGAGCATAATACATGTTATCGAATGCATTGGGGAACAGCTCAAAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827853 |
Trichome-related Gene from Literature | N/A |