Detail of EST/Unigene BG448766 |
Acc. | BG448766 |
Internal Acc. | NF045B09NR1F1074 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=0; Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=3e-91; Lichenase OS=Nicotiana plumbaginifolia E-value=1e-71; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=1e-70; Glucan endo-1,3-beta-glucosidase, basic isoform 2 OS=Solanum tuberosum E-value=4e-69; |
Length | 697 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_NOD_ROOT; |
Sequence | GGCAAATCCTTCTTTCATATTCATTTTTAGTGTATACTTTATTTTGCATCATACCTTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827320 |
Trichome-related Gene from Literature | N/A |