| Detail of EST/Unigene BG448816 |
| Acc. | BG448816 |
| Internal Acc. | NF001H07IN1F1064 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Carbamoyl-phosphate synthase small chain OS=Teredinibacter turnerae (strain ATCC 39867 / T7901) E-value=6e-23; Carbamoyl-phosphate synthase small chain OS=Vibrio cholerae serotype O1 (strain ATCC 39315 / El Tor Inaba N16961) E-value=7e-23; Carbamoyl-phosphate synthase small chain OS=Vibrio parahaemolyticus serotype O3:K6 (strain RIMD 2210633) E-value=2e-22; Carbamoyl-phosphate synthase small chain OS=Photobacterium profundum E-value=3e-22; Carbamoyl-phosphate synthase small chain OS=Xanthomonas campestris pv. campestris (strain ATCC 33913 / NCPPB 528 / LMG 568) E-value=6e-22; |
| Length | 526 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CCGAATCCTCTGTTAATCACCCCACTCTCTCGCAGCTCGCATCCCTGACACCGGCGACGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Nucleotide Metabolism > ko00240 Pyrimidine metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00252 Alanine and aspartate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K11540 carbamoyl-phosphate synthase / aspartate carbamoyltransferase / dihydroorotase |
| EC | 2.1.3.2 3.5.2.3 6.3.5.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 822396 |
| Trichome-related Gene from Literature | N/A |