Detail of EST/Unigene BG448973 |
Acc. | BG448973 |
Internal Acc. | NF002H09IN1F1080 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 29 kDa ribonucleoprotein B, chloroplastic OS=Nicotiana sylvestris E-value=1e-12; 31 kDa ribonucleoprotein, chloroplastic OS=Nicotiana plumbaginifolia E-value=3e-12; 28 kDa ribonucleoprotein, chloroplastic OS=Spinacia oleracea E-value=1e-11; Ribonucleoprotein At2g37220, chloroplastic OS=Arabidopsis thaliana E-value=2e-11; 29 kDa ribonucleoprotein A, chloroplastic OS=Nicotiana sylvestris E-value=4e-11; |
Length | 439 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_INSECT; |
Sequence | GTCAAATGTCTACGTTCCAAAAACTCCTCATTAGATACATCTTCAAACCGCATGTTTGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842294 |
Trichome-related Gene from Literature | N/A |