| Detail of EST/Unigene BG449027 |
| Acc. | BG449027 |
| Internal Acc. | NF003H08IN1F1076 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Salvelinus fontinalis E-value=6e-53; NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Mus musculus E-value=3e-51; NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Homo sapiens E-value=5e-51; NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Rattus norvegicus E-value=2e-50; NADPH:adrenodoxin oxidoreductase, mitochondrial OS=Bos taurus E-value=4e-50; |
| Length | 661 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | TAATCTCGTCCTCGCGCCGTCGTTTCTGTGCCGCCGCTCTTTGCACTGTCGTATTGTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.18.1.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829370 |
| Trichome-related Gene from Literature | N/A |