| Detail of EST/Unigene BG449069 |
| Acc. | BG449069 |
| Internal Acc. | NF001G06IN1F1052 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 14 OS=Arabidopsis thaliana E-value=5e-71; Glucan endo-1,3-beta-glucosidase 11 OS=Arabidopsis thaliana E-value=7e-60; Glucan endo-1,3-beta-glucosidase 10 OS=Arabidopsis thaliana E-value=3e-53; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=7e-39; Lichenase OS=Nicotiana plumbaginifolia E-value=8e-38; |
| Length | 668 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_INSECT; |
| Sequence | CACCATTTCAGATTCATTTATGCAAATCAATGGCCTAAGTTTTGGAATAAACTATGGACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817295 |
| Trichome-related Gene from Literature | N/A |